Our drug discovery model has identified two novel STAT3 SH2 domain inhibitors 323–1 and 323–2 (delavatine A stereoisomers) in a series of experiments. In silico computational modeling, drug affinity ...
The shRNA sequences were as follows: sh1: GGAATGAATTGTAGGTTTATA, sh2: GGCCGGTAGTTGATGAAATTT ... and invasion of esophageal squamous cell carcinoma by upregulating STAT3 and downregulating miR-124 ...
"In the amygdala, the gene Stat3 is involved in the regulation of blood pressure and possibly plays a role in blood pressure elevation in response to chronic stress. It might also be involved in ...
Nairobi — The Ministry of Environment has launched a Sh2.8 billion state-of-the-art forest firefighting and surveillance project for the Kenya Forest Service (KFS) to help combat forest fires in ...
Vipingo Ridge Services Limited has been ordered to pay its former Human Resources manager a total of Sh2.2 million as compensation, for unfair termination of employment and one month's salary in ...
According to DP Kithure Kindiki, the, construction of 132kV Rabai-Bomani-Kilifi Transmission Line and the 132/33kV Bomani Substation at a cost of Sh3.4 billion is currently ongoing and will be ...
According to the committee’s report, the National Police Service (NPS) will receive an additional Sh7.5 billion, with Sh5 billion set aside for insurance-related costs and Sh2.5 billion earmarked for ...
Our aim was thus to clarify the role of STAT3 during fetal lung development. Materials and Methods The STAT3 expression pattern was assessed by immunohistochemistry. Rat lung explants were harvested ...
Hubble’s infrared image reveals young stars in Sh2-284 The nebula’s low-metallicity mirrors early universe conditions Infrared imaging offers insights into hidden star formations ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results
Feedback